Transcript: Human NM_198868.3

Homo sapiens TBC1 domain family member 9B (TBC1D9B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
TBC1D9B (23061)
Length:
5206
CDS:
77..3829

Additional Resources:

NCBI RefSeq record:
NM_198868.3
NBCI Gene record:
TBC1D9B (23061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055510 CGAGCTATACCTGTGGACATT pLKO.1 2495 CDS 100% 4.950 6.930 N TBC1D9B n/a
2 TRCN0000300238 CGAGCTATACCTGTGGACATT pLKO_005 2495 CDS 100% 4.950 6.930 N TBC1D9B n/a
3 TRCN0000055511 CAAGGGCAAGATACACGGAAT pLKO.1 409 CDS 100% 4.050 3.240 N TBC1D9B n/a
4 TRCN0000300239 CAAGGGCAAGATACACGGAAT pLKO_005 409 CDS 100% 4.050 3.240 N TBC1D9B n/a
5 TRCN0000310787 ATTGAGCAGATGCGGTTTAAA pLKO_005 2420 CDS 100% 15.000 10.500 N TBC1D9B n/a
6 TRCN0000055512 CTGGGCAGATACCTGGATAAT pLKO.1 2255 CDS 100% 13.200 9.240 N TBC1D9B n/a
7 TRCN0000303936 AGCTGCACCTGCCTAGCATTA pLKO_005 4102 3UTR 100% 10.800 7.560 N TBC1D9B n/a
8 TRCN0000369932 TGAGCTGTGCAAGACGCTTTA pLKO_005 3160 CDS 100% 10.800 7.560 N TBC1D9B n/a
9 TRCN0000055508 CCAACCTGAAAGACCGTGATT pLKO.1 1209 CDS 100% 4.950 3.465 N TBC1D9B n/a
10 TRCN0000331296 CCAACCTGAAAGACCGTGATT pLKO_005 1209 CDS 100% 4.950 3.465 N TBC1D9B n/a
11 TRCN0000055509 CCTGAAAGTGTCCTATGAGAA pLKO.1 2374 CDS 100% 4.950 3.465 N TBC1D9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15748 pDONR223 0% 40.7% 40.7% None 1_2169del;2861_2911del;3356A>C n/a
2 ccsbBroad304_15748 pLX_304 0% 40.7% 40.7% V5 1_2169del;2861_2911del;3356A>C n/a
3 ccsbBroadEn_11668 pDONR223 98.8% 31.2% 31.1% None (many diffs) n/a
4 ccsbBroad304_11668 pLX_304 0% 31.2% 31.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV