Transcript: Mouse NM_198967.5

Mus musculus transmembrane and tetratricopeptide repeat containing 1 (Tmtc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmtc1 (387314)
Length:
8346
CDS:
154..2982

Additional Resources:

NCBI RefSeq record:
NM_198967.5
NBCI Gene record:
Tmtc1 (387314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198967.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191778 GCTGAAGGAATCCATTAAATA pLKO.1 2043 CDS 100% 15.000 21.000 N Tmtc1 n/a
2 TRCN0000192782 CCAGATTATCACTAAGCACTT pLKO.1 3493 3UTR 100% 4.050 2.835 N Tmtc1 n/a
3 TRCN0000201426 CCTTACAAGGTTCCTTACCTA pLKO.1 1263 CDS 100% 3.000 2.100 N Tmtc1 n/a
4 TRCN0000191331 CCAGAAATACAGAAACTCAAA pLKO.1 3289 3UTR 100% 4.950 2.970 N Tmtc1 n/a
5 TRCN0000201698 GTCAGACCAAAGAAGCTGAAA pLKO.1 2525 CDS 100% 4.950 2.970 N Tmtc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198967.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09120 pDONR223 100% 69.1% 73% None (many diffs) n/a
2 ccsbBroad304_09120 pLX_304 0% 69.1% 73% V5 (many diffs) n/a
Download CSV