Transcript: Human NM_199076.3

Homo sapiens cyclin and CBS domain divalent metal cation transport mediator 2 (CNNM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CNNM2 (54805)
Length:
15791
CDS:
188..2749

Additional Resources:

NCBI RefSeq record:
NM_199076.3
NBCI Gene record:
CNNM2 (54805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045236 GCACCGTCTATAACCGGGAAA pLKO.1 1404 CDS 100% 4.050 5.670 N CNNM2 n/a
2 TRCN0000452962 CGCTATGCTGGAAGAATTTAA pLKO_005 1783 CDS 100% 15.000 10.500 N CNNM2 n/a
3 TRCN0000045235 CCGGGAACGAAAGCAAGATTT pLKO.1 1984 CDS 100% 13.200 9.240 N CNNM2 n/a
4 TRCN0000451474 GACAGTGAGATGAAGGTTAAA pLKO_005 2024 CDS 100% 13.200 9.240 N CNNM2 n/a
5 TRCN0000045237 GCAGCAATAACCAGCTCAATT pLKO.1 2451 CDS 100% 13.200 9.240 N CNNM2 n/a
6 TRCN0000045233 GCCCAAATAGAATCATGTTTA pLKO.1 2993 3UTR 100% 13.200 7.920 N CNNM2 n/a
7 TRCN0000045234 CCCAGTCTTCAGACAGTGAAA pLKO.1 2595 CDS 100% 4.950 2.970 N CNNM2 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 14213 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 14045 3UTR 100% 4.950 2.475 Y C16orf89 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 14213 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08409 pDONR223 100% 64.1% 62.7% None (many diffs) n/a
2 ccsbBroad304_08409 pLX_304 0% 64.1% 62.7% V5 (many diffs) n/a
3 TRCN0000480940 CATGTGCACTTAGTAGCCCGGATT pLX_317 24.7% 64.1% 62.7% V5 (many diffs) n/a
Download CSV