Transcript: Mouse NM_199238.3

Mus musculus sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (Sema6d), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sema6d (214968)
Length:
6296
CDS:
820..3816

Additional Resources:

NCBI RefSeq record:
NM_199238.3
NBCI Gene record:
Sema6d (214968)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000453406 GAGCGCTACGGATCGTGTAAA pLKO_005 2365 CDS 100% 13.200 18.480 N Sema6d n/a
2 TRCN0000112325 GCCACCAACAAACTATGTTAA pLKO.1 4388 3UTR 100% 13.200 18.480 N Sema6d n/a
3 TRCN0000112327 CGGTTGACTATCACTATTCAA pLKO.1 914 CDS 100% 5.625 7.875 N Sema6d n/a
4 TRCN0000112328 GCCATAGAATATGGAAACTAT pLKO.1 1495 CDS 100% 5.625 4.500 N Sema6d n/a
5 TRCN0000112326 GCAGTCTATAACAGACATAAT pLKO.1 1710 CDS 100% 13.200 9.240 N Sema6d n/a
6 TRCN0000450080 GGATCTGCCCTTCGCACAATA pLKO_005 1432 CDS 100% 13.200 9.240 N Sema6d n/a
7 TRCN0000112329 GCCACCAAACACGGATACAAA pLKO.1 2838 CDS 100% 5.625 3.938 N Sema6d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04171 pDONR223 100% 87.3% 93.9% None (many diffs) n/a
2 ccsbBroad304_04171 pLX_304 0% 87.3% 93.9% V5 (many diffs) n/a
3 TRCN0000475909 ACCAAGAGATGATGTTGTTTATAG pLX_317 10.6% 87.3% 93.9% V5 (many diffs) n/a
Download CSV