Transcript: Mouse NM_199299.3

Mus musculus jade family PHD finger 2 (Jade2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Jade2 (76901)
Length:
6100
CDS:
172..2661

Additional Resources:

NCBI RefSeq record:
NM_199299.3
NBCI Gene record:
Jade2 (76901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417756 ATTACCAAGATCTCGCATATT pLKO_005 1057 CDS 100% 13.200 18.480 N Jade2 n/a
2 TRCN0000103900 CGGACTATATTAGCTGACAAT pLKO.1 1207 CDS 100% 4.950 6.930 N Jade2 n/a
3 TRCN0000359623 GGCCTGGAAATGCGGACTATA pLKO_005 1195 CDS 100% 13.200 10.560 N JADE2 n/a
4 TRCN0000103904 CCATCTACAGATGAAACTTAT pLKO.1 1683 CDS 100% 13.200 9.240 N Jade2 n/a
5 TRCN0000018514 GCCTGGAAATGCGGACTATAT pLKO.1 1196 CDS 100% 13.200 9.240 N JADE2 n/a
6 TRCN0000103903 CTGTCAGAGGAATTGCTACAA pLKO.1 1996 CDS 100% 4.950 3.465 N Jade2 n/a
7 TRCN0000103902 CCACATCAGCATCAAGATGTT pLKO.1 242 CDS 100% 0.495 0.347 N Jade2 n/a
8 TRCN0000103901 GCTTCCGACTTAAATGTCCAA pLKO.1 2350 CDS 100% 2.640 1.584 N Jade2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11722 pDONR223 100% 83% 86.5% None (many diffs) n/a
2 ccsbBroad304_11722 pLX_304 0% 83% 86.5% V5 (many diffs) n/a
3 TRCN0000472266 TAGGATTCGATGTGTTACGACTGG pLX_317 17.6% 83% 86.5% V5 (many diffs) n/a
Download CSV