Transcript: Mouse NM_199305.1

Mus musculus transmembrane protein 39b (Tmem39b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem39b (230770)
Length:
1845
CDS:
121..1599

Additional Resources:

NCBI RefSeq record:
NM_199305.1
NBCI Gene record:
Tmem39b (230770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242805 ATCCGTTTGGGATGTACATTC pLKO_005 707 CDS 100% 10.800 15.120 N TMEM39B n/a
2 TRCN0000124004 CCAGGGTGATCCTCCAAACAA pLKO.1 1603 3UTR 100% 5.625 4.500 N Tmem39b n/a
3 TRCN0000124005 GCACTACATCAACATCTATAA pLKO.1 402 CDS 100% 13.200 9.240 N Tmem39b n/a
4 TRCN0000124008 CTGGTGAAACACAGCAAGAAT pLKO.1 1270 CDS 100% 5.625 3.938 N Tmem39b n/a
5 TRCN0000124006 GCCTACTATGTGGCCTTTGTA pLKO.1 1009 CDS 100% 5.625 3.938 N Tmem39b n/a
6 TRCN0000167888 CTTCAGCAACTACTATGCCTT pLKO.1 1488 CDS 100% 2.640 1.848 N TMEM39B n/a
7 TRCN0000124007 CTCCTTAATGTCCTCAGAGAA pLKO.1 1434 CDS 100% 4.950 2.970 N Tmem39b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12160 pDONR223 100% 44.1% 47.1% None (many diffs) n/a
2 ccsbBroad304_12160 pLX_304 0% 44.1% 47.1% V5 (many diffs) n/a
3 TRCN0000480932 GTTCCCGCACCGGTAAAGCACCGC pLX_317 62.4% 44.1% 47.1% V5 (many diffs) n/a
Download CSV