Transcript: Mouse NM_199319.3

Mus musculus synovial sarcoma, X member B5 (Ssxb5), mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Ssxb5 (387586)
Length:
602
CDS:
79..558

Additional Resources:

NCBI RefSeq record:
NM_199319.3
NBCI Gene record:
Ssxb5 (387586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234095 GGAAGTATCGAGTGATATATT pLKO_005 494 CDS 100% 15.000 7.500 Y Ssxb10 n/a
2 TRCN0000243618 ACATCAGTGACAATAAGTATT pLKO_005 373 CDS 100% 13.200 6.600 Y Gm5751 n/a
3 TRCN0000431954 AGAGGAAGAAGATGATGATTA pLKO_005 534 CDS 100% 13.200 6.600 Y Ssxb1 n/a
4 TRCN0000226358 AGCTGACATCAGTGACAATAA pLKO_005 368 CDS 100% 13.200 6.600 Y Gm6592 n/a
5 TRCN0000234093 AGCTGACATCAGTGACAATAA pLKO_005 368 CDS 100% 13.200 6.600 Y Ssxb10 n/a
6 TRCN0000201289 GAGGAAGTATCGAGTGATATA pLKO.1 492 CDS 100% 13.200 6.600 Y Ssxb9 n/a
7 TRCN0000226359 GAGGAAGTATCGAGTGATATA pLKO_005 492 CDS 100% 13.200 6.600 Y Gm6592 n/a
8 TRCN0000239469 GCTGACATCAGTGACAATAAG pLKO_005 369 CDS 100% 13.200 6.600 Y Ssxb5 n/a
9 TRCN0000239470 CAAGGAGCAGGCCAAGCAATT pLKO_005 264 CDS 100% 10.800 5.400 Y Ssxb5 n/a
10 TRCN0000239468 TCATGACAGTGAAGATGAATG pLKO_005 306 CDS 100% 10.800 5.400 Y Ssxb5 n/a
11 TRCN0000239466 TGATTCCAACTTGGCAGAAAC pLKO_005 429 CDS 100% 10.800 5.400 Y Ssxb5 n/a
12 TRCN0000239831 TGCCTCTGGAGAGAATGATTC pLKO_005 414 CDS 100% 10.800 5.400 Y LOC639496 n/a
13 TRCN0000234094 TGGCATTCAGGTCAATGTTTG pLKO_005 453 CDS 100% 10.800 5.400 Y Ssxb10 n/a
14 TRCN0000239467 TTCCAGGATATTTCTACATAC pLKO_005 118 CDS 100% 10.800 5.400 Y Ssxb5 n/a
15 TRCN0000265665 ACAGTGAAGATGAATGCTTTG pLKO_005 311 CDS 100% 6.000 3.000 Y Ssxb8 n/a
16 TRCN0000265670 GAAGTGCTTTATGAACCAAAG pLKO_005 82 CDS 100% 6.000 3.000 Y Ssxb8 n/a
17 TRCN0000243691 AGGCCTTCCAGGATATTTCTA pLKO_005 113 CDS 100% 5.625 2.813 Y Gm14459 n/a
18 TRCN0000243615 AGTGCCTACGTGTACATGAAA pLKO_005 181 CDS 100% 5.625 2.813 Y Gm5751 n/a
19 TRCN0000175939 GATGGCATTCAGGTCAATGTT pLKO.1 451 CDS 100% 5.625 2.813 Y Ssxb3 n/a
20 TRCN0000257412 GATGGCATTCAGGTCAATGTT pLKO_005 451 CDS 100% 5.625 2.813 Y Gm6592 n/a
21 TRCN0000265658 AGGATATTTCTACATACTTCT pLKO_005 122 CDS 100% 4.950 2.475 Y Ssxb8 n/a
22 TRCN0000150618 GAAGAGGAAGAAGATGATGAT pLKO.1 532 CDS 100% 4.950 2.475 Y SAMD1 n/a
23 TRCN0000192532 GAAGATCATGACAGTGAAGAT pLKO.1 301 CDS 100% 4.950 2.475 Y Ssxb5 n/a
24 TRCN0000194219 GAGAGGAAGTATCGAGTGATA pLKO.1 490 CDS 100% 4.950 2.475 Y Ssxb10 n/a
25 TRCN0000175709 GATTCCAACTTGGCAGAAACT pLKO.1 430 CDS 100% 4.950 2.475 Y Ssxb3 n/a
26 TRCN0000426599 ACATCAGAATGACTGACCTAG pLKO_005 209 CDS 100% 4.050 2.025 Y Ssxb1 n/a
27 TRCN0000234096 GAAATAAGCCCACGGTGGAAG pLKO_005 569 3UTR 100% 4.050 2.025 Y Ssxb10 n/a
28 TRCN0000175333 CTACATCAGAATGACTGACCT pLKO.1 207 CDS 100% 2.640 1.320 Y Ssxb3 n/a
29 TRCN0000194397 CTTGGCAGAAACTGATGGCAT pLKO.1 438 CDS 100% 2.640 1.320 Y Ssxb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.