Transcript: Human NM_199340.4

Homo sapiens leucine rich repeat containing 37 member A3 (LRRC37A3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LRRC37A3 (374819)
Length:
6047
CDS:
678..5582

Additional Resources:

NCBI RefSeq record:
NM_199340.4
NBCI Gene record:
LRRC37A3 (374819)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199340.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183215 GCGTTAATTGTGACTGGAATA pLKO.1 5430 CDS 100% 10.800 7.560 N LRRC37A3 n/a
2 TRCN0000265548 AGGTGAGGATCAAGCTTATTA pLKO_005 1532 CDS 100% 15.000 7.500 Y LRRC37A2 n/a
3 TRCN0000254452 TCAATCTCCGGAACCTATTAA pLKO_005 2117 CDS 100% 15.000 7.500 Y LRRC37A2 n/a
4 TRCN0000254451 AGACTTAACCCACGCTATTTC pLKO_005 4496 CDS 100% 13.200 6.600 Y LRRC37A2 n/a
5 TRCN0000254450 TCACCATCAAACTCATCATTT pLKO_005 1871 CDS 100% 13.200 6.600 Y LRRC37A2 n/a
6 TRCN0000121902 CCAGCGTTACAGTTCAACTTT pLKO.1 2488 CDS 100% 5.625 2.813 Y LRRC37A n/a
7 TRCN0000142878 CCATGACAGAGGTTGAACTTT pLKO.1 2347 CDS 100% 5.625 2.813 Y LRRC37A n/a
8 TRCN0000143055 CCCAAGAAGCTGAAGAAAGAT pLKO.1 1116 CDS 100% 5.625 2.813 Y LRRC37A n/a
9 TRCN0000167461 GATGTGAAATCACTGTTACTA pLKO.1 4074 CDS 100% 5.625 2.813 Y LRRC37A2 n/a
10 TRCN0000179998 CCAATGGAAGACTGAGAACTA pLKO.1 5309 CDS 100% 4.950 2.475 Y LRRC37A3 n/a
11 TRCN0000141309 CCAGGTCACCATCAAACTCAT pLKO.1 1866 CDS 100% 4.950 2.475 Y LRRC37A n/a
12 TRCN0000180259 CCTCCTATGGAGCATGAACTT pLKO.1 1722 CDS 100% 4.950 2.475 Y LRRC37A3 n/a
13 TRCN0000144003 CCTTGCTGAGATTATTGGAAT pLKO.1 1154 CDS 100% 4.950 2.475 Y LRRC37A n/a
14 TRCN0000145536 CGAAGGTCATTACAAGAAGAT pLKO.1 5499 CDS 100% 4.950 2.475 Y LRRC37A n/a
15 TRCN0000142354 GCAGATGTGGAGGTTACCATA pLKO.1 1581 CDS 100% 4.950 2.475 Y LRRC37A n/a
16 TRCN0000180805 GCGGAGATGAGATGTTGTCAT pLKO.1 3184 CDS 100% 4.950 2.475 Y LRRC37A3 n/a
17 TRCN0000142010 GCTGGACCTTTAGCAGTTCAA pLKO.1 2082 CDS 100% 4.950 2.475 Y LRRC37A n/a
18 TRCN0000144231 CATCCAAGATAGAATGGGATA pLKO.1 5284 CDS 100% 4.050 2.025 Y LRRC37A n/a
19 TRCN0000180204 CCATCATTCCAGAACCCACTA pLKO.1 2938 CDS 100% 4.050 2.025 Y LRRC37A3 n/a
20 TRCN0000143717 GAAAGACTTAACCCACGCTAT pLKO.1 4493 CDS 100% 4.050 2.025 Y LRRC37A n/a
21 TRCN0000180361 GCCACAGTTCAACCTTTGGAT pLKO.1 2301 CDS 100% 3.000 1.500 Y LRRC37A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199340.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13034 pDONR223 100% 44.1% 39% None (many diffs) n/a
2 ccsbBroad304_13034 pLX_304 0% 44.1% 39% V5 (many diffs) n/a
3 TRCN0000466676 ACGATCGTGATATACAATGGCACG pLX_317 15.7% 44.1% 39% V5 (many diffs) n/a
Download CSV