Transcript: Human NM_199424.3

Homo sapiens WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
WWP2 (11060)
Length:
3624
CDS:
530..1825

Additional Resources:

NCBI RefSeq record:
NM_199424.3
NBCI Gene record:
WWP2 (11060)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320921 GCGGATGGCAGTCTGGAATAA pLKO_005 2009 3UTR 100% 13.200 18.480 N WWP2 n/a
2 TRCN0000320849 CTCACCTACTTTCGCTTTATA pLKO_005 1016 CDS 100% 15.000 10.500 N WWP2 n/a
3 TRCN0000001514 CCTCACCTACTTTCGCTTTAT pLKO.1 1015 CDS 100% 13.200 9.240 N WWP2 n/a
4 TRCN0000320850 TGCGCTACTTTGACGAGAAAG pLKO_005 1422 CDS 100% 10.800 7.560 N WWP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07739 pDONR223 100% 49.4% 49.5% None 0_1ins1317;390T>C;774A>G n/a
2 ccsbBroad304_07739 pLX_304 0% 49.4% 49.5% V5 0_1ins1317;390T>C;774A>G n/a
3 TRCN0000480373 GATAAACCGGCTAAGACCGCAGGC pLX_317 18.6% 49.4% 49.5% V5 0_1ins1317;390T>C;774A>G n/a
Download CSV