Transcript: Mouse NM_199473.2

Mus musculus collagen, type VIII, alpha 2 (Col8a2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Col8a2 (329941)
Length:
4331
CDS:
200..2299

Additional Resources:

NCBI RefSeq record:
NM_199473.2
NBCI Gene record:
Col8a2 (329941)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091605 CGAGTACATCCATTCGTCCTT pLKO.1 2251 CDS 100% 2.640 3.696 N Col8a2 n/a
2 TRCN0000091604 CAGGTATTACTGTCCCTGGAA pLKO.1 687 CDS 100% 2.640 2.112 N Col8a2 n/a
3 TRCN0000091606 CCTAGGACAGAAAGGTGACTT pLKO.1 1516 CDS 100% 4.950 3.465 N Col8a2 n/a
4 TRCN0000091607 CGAGGAGACCAAGGGCCTAAT pLKO.1 1364 CDS 100% 3.600 2.520 N Col8a2 n/a
5 TRCN0000091603 GCCTTTAGAGAAGGATTCTAA pLKO.1 3983 3UTR 100% 0.563 0.394 N Col8a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10741 pDONR223 100% 53.2% 57.6% None (many diffs) n/a
2 ccsbBroad304_10741 pLX_304 0% 53.2% 57.6% V5 (many diffs) n/a
3 TRCN0000471426 AGATATAACTATTCGACCGTACTC pLX_317 33.8% 53.2% 57.6% V5 (many diffs) n/a
Download CSV