Transcript: Human NM_201413.3

Homo sapiens amyloid beta precursor protein (APP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
APP (351)
Length:
3526
CDS:
151..2406

Additional Resources:

NCBI RefSeq record:
NM_201413.3
NBCI Gene record:
APP (351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011043 GCCATCTTTGACCGAAACGAA pLKO.1 1875 CDS 100% 3.000 4.200 N APP n/a
2 TRCN0000318477 GCCATCTTTGACCGAAACGAA pLKO_005 1875 CDS 100% 3.000 4.200 N APP n/a
3 TRCN0000006706 CGCTGCTTAGTTGGTGAGTTT pLKO.1 496 CDS 100% 4.950 3.960 N APP n/a
4 TRCN0000006705 CCCTGTTCATTGTAAGCACTT pLKO.1 3101 3UTR 100% 4.050 2.835 N APP n/a
5 TRCN0000349493 CCCTGTTCATTGTAAGCACTT pLKO_005 3101 3UTR 100% 4.050 2.835 N APP n/a
6 TRCN0000006707 GCAGACACAGACTATGCAGAT pLKO.1 787 CDS 100% 4.050 2.835 N APP n/a
7 TRCN0000318475 GCAGACACAGACTATGCAGAT pLKO_005 787 CDS 100% 4.050 2.835 N APP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489725 CCATTTGTTTAATCGGTTTCATTC pLX_317 17.3% 92.5% 92.4% V5 (not translated due to prior stop codon) 866_1033del n/a
2 TRCN0000488121 TATATTTGTCGTTCATTTAGTTTT pLX_317 14.2% 92.4% 92.1% V5 (not translated due to prior stop codon) 866_1033del;1953_1954delGAinsTC n/a
3 TRCN0000489208 GGCGGCCGGTGCCCTGCTTTGACC pLX_317 18.5% 92.3% 91.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10683 pDONR223 100% 39.5% 38.7% None (many diffs) n/a
5 ccsbBroad304_10683 pLX_304 0% 39.5% 38.7% V5 (many diffs) n/a
6 TRCN0000479912 GGTACCCAGATTCAGTATATAAGT pLX_317 43.5% 39.5% 38.7% V5 (many diffs) n/a
Download CSV