Transcript: Human NM_203422.4

Homo sapiens LRRN4 C-terminal like (LRRN4CL), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LRRN4CL (221091)
Length:
2212
CDS:
110..826

Additional Resources:

NCBI RefSeq record:
NM_203422.4
NBCI Gene record:
LRRN4CL (221091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412333 TTTAAGCGGCCAGATAATAAA pLKO_005 1071 3UTR 100% 15.000 21.000 N LRRN4CL n/a
2 TRCN0000165356 GCTTGTTTAGGTCCGGTACTT pLKO.1 992 3UTR 100% 4.950 6.930 N LRRN4CL n/a
3 TRCN0000162687 CATTTATGTCGTTTGCGTAGT pLKO.1 550 CDS 100% 4.050 5.670 N LRRN4CL n/a
4 TRCN0000166002 GCGAACCTATAGTAGCAGCTA pLKO.1 1201 3UTR 100% 2.640 3.696 N LRRN4CL n/a
5 TRCN0000162898 GCATTTATGTCGTTTGCGTAG pLKO.1 549 CDS 100% 2.250 3.150 N LRRN4CL n/a
6 TRCN0000416222 GGATATTATTATGTGGGTATT pLKO_005 1128 3UTR 100% 10.800 8.640 N LRRN4CL n/a
7 TRCN0000419804 TATGACCTTTGTAACCATTTA pLKO_005 1151 3UTR 100% 13.200 9.240 N LRRN4CL n/a
8 TRCN0000163617 CCTTTGCGGTTTAAGAGGATA pLKO.1 1100 3UTR 100% 4.950 3.465 N LRRN4CL n/a
9 TRCN0000164366 CAAGACTTTGAAGAAGAGGAG pLKO.1 185 CDS 100% 2.160 1.296 N LRRN4CL n/a
10 TRCN0000165337 GACTTTGAAGAAGAGGAGGCA pLKO.1 188 CDS 100% 0.660 0.396 N LRRN4CL n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1669 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1670 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05250 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05250 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466665 CTGTCATACTGTACAAAATCCGGC pLX_317 53.6% 100% 100% V5 n/a
Download CSV