Transcript: Human NM_205548.3

Homo sapiens family with sequence similarity 151 member B (FAM151B), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FAM151B (167555)
Length:
1586
CDS:
25..855

Additional Resources:

NCBI RefSeq record:
NM_205548.3
NBCI Gene record:
FAM151B (167555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_205548.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424431 CACGTGGCCTAGTCTAATAAT pLKO_005 1063 3UTR 100% 15.000 21.000 N FAM151B n/a
2 TRCN0000136920 CCGATATTCTTCCTGGTCCAA pLKO.1 419 CDS 100% 2.640 3.696 N FAM151B n/a
3 TRCN0000137184 GCTGAGATCACCTGGTATCAT pLKO.1 115 CDS 100% 5.625 4.500 N FAM151B n/a
4 TRCN0000416866 GAACACAGCCAGCCAATTATG pLKO_005 226 CDS 100% 13.200 9.240 N FAM151B n/a
5 TRCN0000341989 GGCATCCTGAGAAAGTCAATG pLKO_005 536 CDS 100% 10.800 7.560 N Fam151b n/a
6 TRCN0000134989 CAGTCTTGTTCTCAGTTACTT pLKO.1 652 CDS 100% 5.625 3.938 N FAM151B n/a
7 TRCN0000133944 CGTTCCAAGTCATCTAATCAA pLKO.1 952 3UTR 100% 5.625 3.938 N FAM151B n/a
8 TRCN0000135345 CTTCTCTCCATTGGTCTGAAT pLKO.1 899 3UTR 100% 4.950 3.465 N FAM151B n/a
9 TRCN0000135777 CCTGTATGGATTAATGCCGAT pLKO.1 403 CDS 100% 2.160 1.512 N FAM151B n/a
10 TRCN0000137149 GTATGCTTACTCTGTGGGCAT pLKO.1 985 3UTR 100% 2.160 1.512 N FAM151B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_205548.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16118 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16118 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475876 CGCTTGTTACAGAAAAAAGCTGAT pLX_317 43.5% 100% 100% V5 n/a
4 ccsbBroadEn_09769 pDONR223 100% 99.8% 99.6% None 23C>A n/a
5 ccsbBroad304_09769 pLX_304 0% 99.8% 99.6% V5 23C>A n/a
6 TRCN0000477655 TGTTGCTGTTGCAAATTAATAGAT pLX_317 40.6% 99.8% 99.6% V5 23C>A n/a
Download CSV