Transcript: Human NM_205767.2

Homo sapiens mitochondrial contact site and cristae organizing system subunit 13 (MICOS13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
MICOS13 (125988)
Length:
904
CDS:
411..767

Additional Resources:

NCBI RefSeq record:
NM_205767.2
NBCI Gene record:
MICOS13 (125988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_205767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231826 AGTTCAGCCAGTACGTGTGTC pLKO_005 571 CDS 100% 4.050 5.670 N MICOS13 n/a
2 TRCN0000231828 CCTGGAATGCAGGCATCATGA pLKO_005 658 CDS 100% 4.950 3.465 N MICOS13 n/a
3 TRCN0000231827 CCCTCCAAAGATTTACTTTCC pLKO_005 626 CDS 100% 4.050 2.835 N MICOS13 n/a
4 TRCN0000231824 GGTTCCTCATCAAGGGAAGTG pLKO_005 439 CDS 100% 4.050 2.835 N MICOS13 n/a
5 TRCN0000231825 CGTCTACCTGGTGTACGACCA pLKO_005 473 CDS 100% 0.720 0.432 N MICOS13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_205767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04804 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04804 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477647 TTATAATTGTTTCACCTCCCCCGT pLX_317 100% 100% 100% V5 n/a
Download CSV