Transcript: Human NM_205850.3

Homo sapiens solute carrier family 24 member 5 (SLC24A5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC24A5 (283652)
Length:
1879
CDS:
56..1558

Additional Resources:

NCBI RefSeq record:
NM_205850.3
NBCI Gene record:
SLC24A5 (283652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_205850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418034 GGCTACTCTCAGCTCTCTATA pLKO_005 875 CDS 100% 13.200 18.480 N SLC24A5 n/a
2 TRCN0000044878 GCCATATCTATTGTCTGTGAT pLKO.1 299 CDS 100% 4.950 6.930 N SLC24A5 n/a
3 TRCN0000044881 GCAGAGGACTAACTTACATAA pLKO.1 1359 CDS 100% 13.200 9.240 N SLC24A5 n/a
4 TRCN0000044882 GCCTGTGGTTTGCTATCTAAT pLKO.1 521 CDS 100% 13.200 9.240 N SLC24A5 n/a
5 TRCN0000435224 ATAGTCTGCCTATTATCATAC pLKO_005 1460 CDS 100% 10.800 7.560 N SLC24A5 n/a
6 TRCN0000044880 CCACAGGAAATAGCACCCAAT pLKO.1 171 CDS 100% 4.050 2.835 N SLC24A5 n/a
7 TRCN0000044879 CCGATACAGTAATGGGCCTTA pLKO.1 1152 CDS 100% 4.050 2.835 N SLC24A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_205850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05364 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05364 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466170 TGGCAGACGGTATGTAAAAATCTA pLX_317 26% 100% 100% V5 n/a
Download CSV