Transcript: Human NM_206814.6

Homo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MOG (4340)
Length:
1694
CDS:
119..514

Additional Resources:

NCBI RefSeq record:
NM_206814.6
NBCI Gene record:
MOG (4340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206814.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373012 TCAGAGTATCCACTGTTTATT pLKO_005 1245 3UTR 100% 15.000 10.500 N MOG n/a
2 TRCN0000373011 GCTGGAAGATAACCCTGTTTG pLKO_005 387 CDS 100% 10.800 7.560 N MOG n/a
3 TRCN0000373067 TGAGCTGAAGAGTGAGGATAT pLKO_005 1010 3UTR 100% 10.800 7.560 N MOG n/a
4 TRCN0000373068 TTCGAGCAGAGATAGAGAATC pLKO_005 327 CDS 100% 10.800 7.560 N MOG n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1355 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000149862 GCAATTCCTTGAAGAGCTACT pLKO.1 481 CDS 100% 4.050 2.835 N MOG n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1356 3UTR 100% 13.200 6.600 Y LIAS n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1521 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206814.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10974 pDONR223 100% 43.9% 43.2% None (many diffs) n/a
2 TRCN0000480215 CGTAATGACCTGCTCAATACACAG pLX_317 48.2% 43.9% 43.2% V5 (many diffs) n/a
Download CSV