Transcript: Human NM_206852.2

Homo sapiens reticulon 1 (RTN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
RTN1 (6252)
Length:
1722
CDS:
309..935

Additional Resources:

NCBI RefSeq record:
NM_206852.2
NBCI Gene record:
RTN1 (6252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206852.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417990 CTAAGAGGCACGCTGAGTAAA pLKO_005 916 CDS 100% 13.200 18.480 N RTN1 n/a
2 TRCN0000427336 TTCCAACACACACAACGTAAA pLKO_005 1404 3UTR 100% 10.800 15.120 N RTN1 n/a
3 TRCN0000179231 GCTCTGATGCAATAGTGGAAA pLKO.1 1302 3UTR 100% 4.950 6.930 N RTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206852.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11112 pDONR223 100% 95.6% 95.6% None 1_27del n/a
2 ccsbBroad304_11112 pLX_304 0% 95.6% 95.6% V5 1_27del n/a
3 TRCN0000470254 CCCCTCTTGGAGGTTCAATCCCAT pLX_317 57.8% 95.6% 95.6% V5 1_27del n/a
4 ccsbBroadEn_11113 pDONR223 100% 28.6% 27.5% None (many diffs) n/a
5 ccsbBroad304_11113 pLX_304 0% 28.6% 27.5% V5 (many diffs) n/a
Download CSV