Transcript: Human NM_206855.3

Homo sapiens QKI, KH domain containing RNA binding (QKI), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
QKI (9444)
Length:
16283
CDS:
477..1436

Additional Resources:

NCBI RefSeq record:
NM_206855.3
NBCI Gene record:
QKI (9444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329418 TGCCAGTCATGCCTGATATTT pLKO_005 2370 3UTR 100% 15.000 21.000 N Qk n/a
2 TRCN0000233374 TAGGTGCGGTGGCTACTAAAG pLKO_005 4409 3UTR 100% 10.800 15.120 N QKI n/a
3 TRCN0000329483 TTATAACACGACCAGTCAATG pLKO_005 2435 3UTR 100% 10.800 15.120 N Qk n/a
4 TRCN0000102408 TGCCTGATATTTCAGCCCATT pLKO.1 2379 3UTR 100% 4.050 5.670 N Qk n/a
5 TRCN0000015186 CCGAAGCTGGTTTAATCTATA pLKO.1 1312 CDS 100% 13.200 10.560 N QKI n/a
6 TRCN0000233373 CCGAAGCTGGTTTAATCTATA pLKO_005 1312 CDS 100% 13.200 10.560 N QKI n/a
7 TRCN0000233371 CTGATGCTGTGGGACCTATTG pLKO_005 694 CDS 100% 10.800 8.640 N QKI n/a
8 TRCN0000015183 GCTACATCAATCCTTGAGTAT pLKO.1 1365 CDS 100% 4.950 3.960 N QKI n/a
9 TRCN0000233375 CTAGCATCATAGTGCATATAA pLKO_005 10179 3UTR 100% 15.000 10.500 N QKI n/a
10 TRCN0000233372 GAAGCAGAAACCGGATGTAAA pLKO_005 816 CDS 100% 13.200 9.240 N QKI n/a
11 TRCN0000015184 CCCTACCATAATGCCTTTGAT pLKO.1 1220 CDS 100% 5.625 3.938 N QKI n/a
12 TRCN0000015185 AGAAACTTTATGTGCCTGTAA pLKO.1 727 CDS 100% 4.950 3.465 N QKI n/a
13 TRCN0000015187 GACGAAGAAATTAGCAGAGTA pLKO.1 612 CDS 100% 4.950 3.465 N QKI n/a
14 TRCN0000102407 GCACCAGCTACATCAATCCTT pLKO.1 1359 CDS 100% 3.000 2.100 N Qk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02164 pDONR223 100% 92.9% 91.4% None (many diffs) n/a
2 ccsbBroad304_02164 pLX_304 0% 92.9% 91.4% V5 (many diffs) n/a
3 TRCN0000467894 CCTGACTCCGTGTACCCTTCACCC pLX_317 41.9% 92.9% 91.4% V5 (many diffs) n/a
Download CSV