Transcript: Human NM_206866.3

Homo sapiens BTB domain and CNC homolog 1 (BACH1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BACH1 (571)
Length:
5810
CDS:
285..2495

Additional Resources:

NCBI RefSeq record:
NM_206866.3
NBCI Gene record:
BACH1 (571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416033 AGCGTCTTGAAAGCCTAATAT pLKO_005 2546 3UTR 100% 15.000 21.000 N BACH1 n/a
2 TRCN0000013594 CCTATGAATCTTCTGTGCATA pLKO.1 313 CDS 100% 4.950 6.930 N BACH1 n/a
3 TRCN0000433926 GCATATCAGACAGCAATTTAA pLKO_005 2811 3UTR 100% 15.000 10.500 N BACH1 n/a
4 TRCN0000430446 GAAATTGGAAACGATGATTAT pLKO_005 1713 CDS 100% 13.200 9.240 N BACH1 n/a
5 TRCN0000013596 CCAGCAAGAATGCCCAAGAAA pLKO.1 692 CDS 100% 5.625 3.938 N BACH1 n/a
6 TRCN0000013593 CCCTAGAATCTGGAGAGCTTA pLKO.1 3341 3UTR 100% 4.950 3.465 N BACH1 n/a
7 TRCN0000013597 GCCCATATGCTTGTGTCATTA pLKO.1 1759 CDS 100% 0.000 0.000 N BACH1 n/a
8 TRCN0000013595 GCTGGATTGTATCCATGATAT pLKO.1 1946 CDS 100% 13.200 7.920 N BACH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00145 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00145 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474028 TACACCTATATAATTACTGTGAGT pLX_317 24.5% 100% 100% V5 n/a
Download CSV