Transcript: Mouse NM_207175.2

Mus musculus olfactory receptor 239 (Olfr239), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Olfr239 (100038860)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_207175.2
NBCI Gene record:
Olfr239 (100038860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202690 CATTGTGGTTACCATCTTGAA pLKO.1 663 CDS 100% 4.950 2.475 Y Olfr55 n/a
2 TRCN0000188056 CCAAGTCTCTGGAAGGAGATA pLKO.1 797 CDS 100% 4.950 2.475 Y Olfr239 n/a
3 TRCN0000185265 GATGTTCTTCTCCTTCACATT pLKO.1 300 CDS 100% 4.950 2.475 Y Olfr239 n/a
4 TRCN0000186971 CTTCTCCTTCACATTTGGCTT pLKO.1 306 CDS 100% 2.640 1.320 Y Olfr55 n/a
5 TRCN0000203388 CCTCTATTGAAGTTGGCATGT pLKO.1 547 CDS 100% 4.050 2.025 Y Olfr239 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08027 pDONR223 100% 83.2% 85.2% None (many diffs) n/a
2 ccsbBroad304_08027 pLX_304 0% 83.2% 85.2% V5 (many diffs) n/a
3 TRCN0000469520 ACGGAGTGAACTCCAGACTTATCC pLX_317 20.1% 83.2% 85.2% V5 (many diffs) n/a
Download CSV