Transcript: Mouse NM_207202.2

Mus musculus coiled-coil domain containing 120 (Ccdc120), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Ccdc120 (54648)
Length:
3641
CDS:
310..2199

Additional Resources:

NCBI RefSeq record:
NM_207202.2
NBCI Gene record:
Ccdc120 (54648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240870 GAGCCTTGAAGTCCGGGTAAT pLKO_005 2398 3UTR 100% 10.800 8.640 N Ccdc120 n/a
2 TRCN0000240871 CCAGGTCCTCCACCCATATAT pLKO_005 1756 CDS 100% 15.000 10.500 N Ccdc120 n/a
3 TRCN0000216857 GAAACCTCCACCATCAGATAT pLKO.1 1089 CDS 100% 13.200 9.240 N Ccdc120 n/a
4 TRCN0000240867 GAGACTTCCTCTTGGACTATC pLKO_005 1622 CDS 100% 10.800 7.560 N Ccdc120 n/a
5 TRCN0000217342 GATGGGTAGGGTTATTGATTC pLKO.1 2191 CDS 100% 10.800 7.560 N Ccdc120 n/a
6 TRCN0000240869 TATCGGTGCAGCAGCAGATTG pLKO_005 665 CDS 100% 10.800 7.560 N Ccdc120 n/a
7 TRCN0000240868 TGATAACGAGGAGCCTCATAG pLKO_005 975 CDS 100% 10.800 7.560 N Ccdc120 n/a
8 TRCN0000178756 CCACCTCTTTAACAGCTTCTT pLKO.1 2507 3UTR 100% 4.950 3.465 N Ccdc120 n/a
9 TRCN0000195859 CCAAGAGGATGTAGTTCTGCA pLKO.1 915 CDS 100% 2.640 1.848 N Ccdc120 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04504 pDONR223 100% 85.6% 89.2% None (many diffs) n/a
2 ccsbBroad304_04504 pLX_304 0% 85.6% 89.2% V5 (many diffs) n/a
3 TRCN0000474151 CCGGCAGTATCTGTGATATCTACG pLX_317 16% 85.6% 89.2% V5 (many diffs) n/a
Download CSV