Transcript: Human NM_207359.2

Homo sapiens glutamate decarboxylase like 1 (GADL1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
GADL1 (339896)
Length:
3655
CDS:
48..1613

Additional Resources:

NCBI RefSeq record:
NM_207359.2
NBCI Gene record:
GADL1 (339896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207359.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078530 AGAGTGTCATTACTCTATGAA pLKO.1 695 CDS 100% 0.563 0.788 N GADL1 n/a
2 TRCN0000078529 GAAAGAGTTAATCGTGCTCTT pLKO.1 1266 CDS 100% 0.405 0.567 N GADL1 n/a
3 TRCN0000078532 GCAGGATAAATTCTATGATGT pLKO.1 1145 CDS 100% 4.950 3.465 N GADL1 n/a
4 TRCN0000078531 CTCAGCTTTGATGTCGAGGAA pLKO.1 965 CDS 100% 2.640 1.848 N GADL1 n/a
5 TRCN0000078528 CCCTGGACTATCAGCATCAAA pLKO.1 1975 3UTR 100% 5.625 3.375 N GADL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207359.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13592 pDONR223 100% 64.6% 64.6% None 1_552del n/a
2 ccsbBroad304_13592 pLX_304 0% 64.6% 64.6% V5 1_552del n/a
3 TRCN0000476531 GAGGTCTCCCAACTGTGCGTGCGT pLX_317 34.7% 64.6% 64.6% V5 1_552del n/a
Download CSV