Transcript: Human NM_207370.4

Homo sapiens G protein-coupled receptor 153 (GPR153), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GPR153 (387509)
Length:
4198
CDS:
384..2213

Additional Resources:

NCBI RefSeq record:
NM_207370.4
NBCI Gene record:
GPR153 (387509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207370.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359823 TAGATAGGATGGCCAAGTATG pLKO_005 1447 CDS 100% 10.800 15.120 N GPR153 n/a
2 TRCN0000063439 CGTGACCACCATAGTCTTCAT pLKO.1 1118 CDS 100% 4.950 6.930 N GPR153 n/a
3 TRCN0000063440 CTATGGCTATGGAGGTGATTT pLKO.1 1418 CDS 100% 13.200 9.240 N GPR153 n/a
4 TRCN0000359822 CAGGAGGACAAGATGCAATAC pLKO_005 1521 CDS 100% 10.800 7.560 N GPR153 n/a
5 TRCN0000063442 CCTAGATAGGATGGCCAAGTA pLKO.1 1445 CDS 100% 4.950 3.465 N GPR153 n/a
6 TRCN0000359821 TCGTGACCACCATAGTCTTCA pLKO_005 1117 CDS 100% 4.950 3.465 N GPR153 n/a
7 TRCN0000063441 CGCCAAGCAGAAGAAGTGGAA pLKO.1 482 CDS 100% 2.640 1.848 N GPR153 n/a
8 TRCN0000063438 GCAGGAGGACAAGATGCAATA pLKO.1 1520 CDS 100% 10.800 6.480 N GPR153 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207370.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489481 GAACTCGCCCCACTTAAGATGCCC pLX_317 12.6% 99.9% 99.8% V5 1827_1828insG n/a
Download CSV