Transcript: Human NM_207398.3

Homo sapiens guanylate binding protein 7 (GBP7), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GBP7 (388646)
Length:
2426
CDS:
103..2019

Additional Resources:

NCBI RefSeq record:
NM_207398.3
NBCI Gene record:
GBP7 (388646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147773 GCTGGCAGTATATTTATTGCA pLKO.1 1900 CDS 100% 3.000 4.200 N GBP7 n/a
2 TRCN0000147866 GCTGCTAAGCTAGTTGATTTA pLKO.1 1933 CDS 100% 13.200 9.240 N GBP7 n/a
3 TRCN0000414984 GGAGTACTCCTTCAAAGATAA pLKO_005 1206 CDS 100% 13.200 9.240 N GBP7 n/a
4 TRCN0000416776 GGGAACAAGTTAGAAGATAAA pLKO_005 2192 3UTR 100% 13.200 9.240 N GBP7 n/a
5 TRCN0000148130 GAACTGCTTACTGAAGGATTT pLKO.1 1774 CDS 100% 10.800 7.560 N GBP7 n/a
6 TRCN0000149815 GCTGAGAAATCCTGGTAAGAA pLKO.1 1986 CDS 100% 5.625 3.938 N GBP7 n/a
7 TRCN0000146806 CCAACTGGATAGTAATTTCCA pLKO.1 867 CDS 100% 3.000 2.100 N GBP7 n/a
8 TRCN0000147527 GCTCATTATGTAATAGGCTGA pLKO.1 1970 CDS 100% 2.160 1.512 N GBP7 n/a
9 TRCN0000437663 AGAGTGACTCGTGGATCTTTG pLKO_005 431 CDS 100% 10.800 6.480 N GBP7 n/a
10 TRCN0000148898 CACAGGCAAATCCTACCTAAT pLKO.1 246 CDS 100% 10.800 6.480 N GBP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488831 ACAGGTAGGTGGAGGCTACATGGC pLX_317 21.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489629 CCCGAAGCGTAATCTCACGGTACA pLX_317 21.3% 99.9% 99.8% V5 1914_1915insG n/a
3 ccsbBroadEn_09417 pDONR223 100% 81.8% 73.8% None (many diffs) n/a
4 ccsbBroad304_09417 pLX_304 0% 81.8% 73.8% V5 (many diffs) n/a
5 TRCN0000479270 CGAGAAGGACTGAAAATCGTTAGT pLX_317 19.1% 81.8% 73.8% V5 (many diffs) n/a
Download CSV