Transcript: Human NM_207417.3

Homo sapiens cilia and flagella associated protein 77 (CFAP77), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CFAP77 (389799)
Length:
1833
CDS:
62..1024

Additional Resources:

NCBI RefSeq record:
NM_207417.3
NBCI Gene record:
CFAP77 (389799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129682 CCGGAATTATATCGCAATGAA pLKO.1 520 CDS 100% 5.625 7.875 N CFAP77 n/a
2 TRCN0000130536 GACCCGGAATTATATCGCAAT pLKO.1 517 CDS 100% 4.050 5.670 N CFAP77 n/a
3 TRCN0000130249 CCCGGAATTATATCGCAATGA pLKO.1 519 CDS 100% 4.950 3.465 N CFAP77 n/a
4 TRCN0000130411 GCCATCTTGACATAGTGGAAA pLKO.1 1049 3UTR 100% 4.950 3.465 N CFAP77 n/a
5 TRCN0000129050 GAAAGCCATCAAACTGGAGAA pLKO.1 769 CDS 100% 4.050 2.835 N CFAP77 n/a
6 TRCN0000128858 GCAGAAAGTTATTCCTTCCCT pLKO.1 313 CDS 100% 0.750 0.525 N CFAP77 n/a
7 TRCN0000130127 CAAACTGGAGAAGAAGCAGAA pLKO.1 778 CDS 100% 4.050 2.430 N CFAP77 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13662 pDONR223 100% 88.7% 88.7% None 194_301del n/a
2 ccsbBroad304_13662 pLX_304 0% 88.7% 88.7% V5 194_301del n/a
3 ccsbBroadEn_14495 pDONR223 100% 88.5% 88.4% None 4C>G;194_301del;543T>C n/a
4 ccsbBroad304_14495 pLX_304 0% 88.5% 88.4% V5 4C>G;194_301del;543T>C n/a
5 TRCN0000479918 ATTTTATCCCTTGATTGCTTAGGA pLX_317 38.6% 88.5% 88.4% V5 4C>G;194_301del;543T>C n/a
Download CSV