Transcript: Mouse NM_207681.2

Mus musculus BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bcl2l11 (12125)
Length:
4872
CDS:
229..651

Additional Resources:

NCBI RefSeq record:
NM_207681.2
NBCI Gene record:
Bcl2l11 (12125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231247 GTCCACACGTGTCGCTAAATC pLKO_005 4472 3UTR 100% 13.200 18.480 N Bcl2l11 n/a
2 TRCN0000231244 GACGAGTTCAACGAAACTTAC pLKO_005 523 CDS 100% 10.800 15.120 N Bcl2l11 n/a
3 TRCN0000009694 CCCGGAGATACGGATTGCACA pLKO.1 483 CDS 100% 0.880 1.232 N Bcl2l11 n/a
4 TRCN0000231246 CTTACAACTGTTACGCTTTAT pLKO_005 603 CDS 100% 13.200 9.240 N Bcl2l11 n/a
5 TRCN0000231243 TGACAGAGAAGGTGGACAATT pLKO_005 264 CDS 100% 13.200 9.240 N Bcl2l11 n/a
6 TRCN0000009692 GTGACAGAGAAGGTGGACAAT pLKO.1 263 CDS 100% 4.950 3.465 N Bcl2l11 n/a
7 TRCN0000009693 TCTCAGGAGGAACCTGAAGAT pLKO.1 457 CDS 100% 0.495 0.347 N Bcl2l11 n/a
8 TRCN0000231245 GGCTGAAGACCACCCTCAAAT pLKO_005 576 CDS 100% 13.200 7.920 N Bcl2l11 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2668 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02292 pDONR223 100% 60.5% 60% None (many diffs) n/a
2 ccsbBroad304_02292 pLX_304 88.4% 60.5% 60% V5 (many diffs) n/a
3 TRCN0000469407 GTCTAGTATATTAGGCACTTGCCG pLX_317 65.9% 60.5% 60% V5 (many diffs) n/a
Download CSV