Transcript: Mouse NM_207682.2

Mus musculus kinesin family member 1B (Kif1b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Kif1b (16561)
Length:
10118
CDS:
340..5652

Additional Resources:

NCBI RefSeq record:
NM_207682.2
NBCI Gene record:
Kif1b (16561)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306188 CCTCAATGAAGACCCATTAAT pLKO_005 1809 CDS 100% 15.000 21.000 N Kif1b n/a
2 TRCN0000091328 GCCGAGAGATTATTGCTGTTA pLKO.1 9292 3UTR 100% 4.950 3.960 N Kif1b n/a
3 TRCN0000326318 GCCGAGAGATTATTGCTGTTA pLKO_005 9292 3UTR 100% 4.950 3.960 N Kif1b n/a
4 TRCN0000306187 ACATGCCTTTGAAGGTTATAA pLKO_005 588 CDS 100% 15.000 10.500 N Kif1b n/a
5 TRCN0000306241 TCGGAGTGTTTGCTCTATTAC pLKO_005 1831 CDS 100% 13.200 9.240 N Kif1b n/a
6 TRCN0000091329 CCCACATTAAAGAGGAGCATT pLKO.1 1922 CDS 100% 4.950 3.465 N Kif1b n/a
7 TRCN0000091332 GCCGACATCAACTACGATGAA pLKO.1 1321 CDS 100% 4.950 3.465 N Kif1b n/a
8 TRCN0000326262 GCCGACATCAACTACGATGAA pLKO_005 1321 CDS 100% 4.950 3.465 N Kif1b n/a
9 TRCN0000091330 GCCCACATTAAAGAGGAGCAT pLKO.1 1921 CDS 100% 2.640 1.848 N Kif1b n/a
10 TRCN0000091331 CCACACTTTCAACCGAGAATT pLKO.1 4971 CDS 100% 0.000 0.000 N Kif1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11674 pDONR223 100% 29.1% 31.2% None (many diffs) n/a
2 ccsbBroad304_11674 pLX_304 0% 29.1% 31.2% V5 (many diffs) n/a
3 TRCN0000469162 GAATGGAGGCACGCGCGGCGGGGA pLX_317 21.6% 29.1% 31.2% V5 (many diffs) n/a
Download CSV