Transcript: Mouse NM_207707.1

Mus musculus estrogen receptor 2 (beta) (Esr2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Esr2 (13983)
Length:
3362
CDS:
348..2051

Additional Resources:

NCBI RefSeq record:
NM_207707.1
NBCI Gene record:
Esr2 (13983)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422469 GGCACGGTTCCGTGAGTTAAA pLKO_005 1610 CDS 100% 13.200 18.480 N Esr2 n/a
2 TRCN0000443109 GAGGACTCATGACGTGTAATG pLKO_005 2520 3UTR 100% 10.800 15.120 N Esr2 n/a
3 TRCN0000026192 GCCATGACATTCTACAGTCCT pLKO.1 537 CDS 100% 2.640 3.696 N Esr2 n/a
4 TRCN0000026170 GATTCTGGAAATCTTTGACAT pLKO.1 1574 CDS 100% 4.950 3.960 N Esr2 n/a
5 TRCN0000026215 GCCACGAATCAGTGTACCATA pLKO.1 963 CDS 100% 4.950 3.960 N Esr2 n/a
6 TRCN0000435939 AGAACGGTGTGGTCATCAAAT pLKO_005 2404 3UTR 100% 13.200 9.240 N Esr2 n/a
7 TRCN0000026150 CTGCTCAGCATGAAGTGCAAA pLKO.1 1884 CDS 100% 4.950 3.465 N Esr2 n/a
8 TRCN0000026230 GCATTGCCTGAACAAAGCCAA pLKO.1 1121 CDS 100% 2.640 1.848 N Esr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489818 TATGATCCCCCGGGCGTATTTAGC pLX_317 24.1% 79% 82.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_10807 pDONR223 100% 47.2% 48.8% None (many diffs) n/a
3 ccsbBroad304_10807 pLX_304 0% 47.2% 48.8% V5 (many diffs) n/a
4 TRCN0000491774 TGGTTTATTTCGGACTCGCAGGAG pLX_317 47.6% 47.2% 48.8% V5 (many diffs) n/a
Download CSV