Transcript: Human NM_214462.5

Homo sapiens dishevelled binding antagonist of beta catenin 2 (DACT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
DACT2 (168002)
Length:
2997
CDS:
145..2469

Additional Resources:

NCBI RefSeq record:
NM_214462.5
NBCI Gene record:
DACT2 (168002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_214462.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428343 GTGCCCAAGCTGTGCCGTATT pLKO_005 2374 CDS 100% 3.600 5.040 N DACT2 n/a
2 TRCN0000436055 ATGGACGAGGCAACATCATAT pLKO_005 1508 CDS 100% 13.200 9.240 N DACT2 n/a
3 TRCN0000424366 TCCTGTGCATGTCTGGGTTTC pLKO_005 2528 3UTR 100% 6.000 4.200 N DACT2 n/a
4 TRCN0000148739 CATGCACCTTGTTTCCATGTT pLKO.1 2752 3UTR 100% 4.950 3.465 N DACT2 n/a
5 TRCN0000425367 ACAACAGGACATCGGCCTGAA pLKO_005 402 CDS 100% 4.050 2.835 N DACT2 n/a
6 TRCN0000180335 CAAGAGAAGTCCCATGGACAA pLKO.1 1641 CDS 100% 4.050 2.835 N DACT2 n/a
7 TRCN0000149172 GTTTCCCAATCCTTTGACCAT pLKO.1 2824 3UTR 100% 2.640 1.848 N DACT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_214462.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13349 pDONR223 100% 47.2% 47.2% None 1_1224del n/a
2 ccsbBroad304_13349 pLX_304 0% 47.2% 47.2% V5 1_1224del n/a
3 TRCN0000478373 TACCCGACCCATGCGGACCGACCC pLX_317 29.8% 47.2% 47.2% V5 1_1224del n/a
Download CSV