Transcript: Human NR_003083.2

Homo sapiens solute carrier family 6 member 10, pseudogene (SLC6A10P), non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
SLC6A10P (386757)
Length:
3839
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003083.2
NBCI Gene record:
SLC6A10P (386757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003083.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370409 ATTACCTGGTCAAGTCCTTTA pLKO_005 1232 3UTR 100% 10.800 5.400 Y SLC6A8 n/a
2 TRCN0000377577 CTCAAGCCTGACTGGTCAAAG pLKO_005 2575 3UTR 100% 10.800 5.400 Y SLC6A8 n/a
3 TRCN0000043475 GTCTTCTGTGTAGCGGCTTTA pLKO.1 3640 3UTR 100% 10.800 5.400 Y SLC6A10P n/a
4 TRCN0000079859 CGTGTACTTCACTGCTACATT pLKO.1 2478 3UTR 100% 5.625 2.813 Y Slc6a8 n/a
5 TRCN0000332016 CGTGTACTTCACTGCTACATT pLKO_005 2478 3UTR 100% 5.625 2.813 Y Slc6a8 n/a
6 TRCN0000043474 CATGGGCATCTTCATCTTCAA pLKO.1 3126 3UTR 100% 4.950 2.475 Y SLC6A10P n/a
7 TRCN0000079861 GCAGCATCAATGTCTGGAACA pLKO.1 327 3UTR 100% 4.050 2.025 Y Slc6a8 n/a
8 TRCN0000332078 GCAGCATCAATGTCTGGAACA pLKO_005 327 3UTR 100% 4.050 2.025 Y Slc6a8 n/a
9 TRCN0000043477 GATGAAATGGTGCTGGTCCTT pLKO.1 3087 3UTR 100% 2.640 1.320 Y SLC6A10P n/a
10 TRCN0000043476 CATTGCCTGTATGATCGGGTA pLKO.1 3051 3UTR 100% 2.160 1.080 Y SLC6A10P n/a
11 TRCN0000043473 ACATCCAGGCTCAAGGCGGAT pLKO.1 3601 3UTR 100% 0.720 0.360 Y SLC6A10P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003083.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.