Transcript: Human NR_003266.2

Homo sapiens succinate dehydrogenase complex flavoprotein subunit A pseudogene (LOC220729), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC220729 (220729)
Length:
1560
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003266.2
NBCI Gene record:
LOC220729 (220729)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028056 CCACAGGAGTCAAGAAACTTT pLKO.1 803 3UTR 100% 5.625 3.375 N LOC220729 n/a
2 TRCN0000028081 CCATCACATAAGAGCAAAGAA pLKO.1 771 3UTR 100% 5.625 3.375 N LOC220729 n/a
3 TRCN0000028099 GAGATATGATACCAGCTGTTT pLKO.1 666 3UTR 100% 4.950 2.970 N LOC220729 n/a
4 TRCN0000028122 TGTTGTTGCCACAGGAGTCAA pLKO.1 795 3UTR 100% 4.950 2.970 N LOC220729 n/a
5 TRCN0000028049 GAACTGAAGATGGGAAGATTT pLKO.1 524 3UTR 100% 13.200 6.600 Y LOC220729 n/a
6 TRCN0000036537 GCATGTGTTACCAAGCTGTTT pLKO.1 301 3UTR 100% 4.950 2.475 Y SDHAP1 n/a
7 TRCN0000028093 GCATCTGCTAAAGTTTCAGAT pLKO.1 165 3UTR 100% 0.495 0.248 Y SDHA n/a
8 TRCN0000297501 GCATCTGCTAAAGTTTCAGAT pLKO_005 165 3UTR 100% 0.495 0.248 Y SDHA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13737 pDONR223 100% 27.3% None (many diffs) n/a
2 ccsbBroad304_13737 pLX_304 0% 27.3% V5 (many diffs) n/a
3 TRCN0000470878 ATACAACTAGATCCCAGAAAGACT pLX_317 74.7% 27.3% V5 (many diffs) n/a
Download CSV