Transcript: Human NR_003506.3

Homo sapiens plasminogen like A (pseudogene) (PLGLA), non-coding RNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Homo sapiens (human)
Gene:
PLGLA (285189)
Length:
841
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003506.3
NBCI Gene record:
PLGLA (285189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413046 CTCTTGTGCAATCCCTAATAT pLKO_005 625 3UTR 100% 15.000 7.500 Y PLGLB2 n/a
2 TRCN0000265829 CTTGTGCAATCCCTAATATAA pLKO_005 627 3UTR 100% 15.000 7.500 Y PLGLB1 n/a
3 TRCN0000255923 ACCTGCAGGGCATTCCAATAT pLKO_005 237 3UTR 100% 13.200 6.600 Y PLGLB1 n/a
4 TRCN0000414226 ATGCTATGTAATCGTTGTTAT pLKO_005 653 3UTR 100% 13.200 6.600 Y PLGLB2 n/a
5 TRCN0000255924 GAGCAACAATGTGTGATAATG pLKO_005 267 3UTR 100% 13.200 6.600 Y PLGLB1 n/a
6 TRCN0000118253 GCATTCCAATATCACAGTAAA pLKO.1 246 3UTR 100% 13.200 6.600 Y PLGLB2 n/a
7 TRCN0000118252 GCCAACTGTATTTAGGATAAT pLKO.1 796 3UTR 100% 13.200 6.600 Y PLGLB2 n/a
8 TRCN0000419153 ATGCTTCTCAAGTCCCTTATG pLKO_005 566 3UTR 100% 10.800 5.400 Y PLGLB2 n/a
9 TRCN0000427309 AGCAACAATGTGTGATAATGG pLKO_005 268 3UTR 100% 4.950 2.475 Y PLGLB2 n/a
10 TRCN0000178840 CTTCACTGTTCAGTGTCACTA pLKO.1 151 3UTR 100% 4.950 2.475 Y PLGLB1 n/a
11 TRCN0000183040 CAATGTGTGATAATGGCTGAA pLKO.1 273 3UTR 100% 4.050 2.025 Y PLGLB1 n/a
12 TRCN0000118256 GTCCTCCATAATCATTAGGAT pLKO.1 302 3UTR 100% 3.000 1.500 Y PLGLB2 n/a
13 TRCN0000118254 GCAGAGAAGAATGTGCAGCAA pLKO.1 193 3UTR 100% 2.640 1.320 Y PLGLB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01217 pDONR223 100% 33.4% None (many diffs) n/a
2 ccsbBroad304_01217 pLX_304 0% 33.4% V5 (many diffs) n/a
3 TRCN0000471881 CTAGCATCATGTCTTCGTAACTGC pLX_317 100% 33.4% V5 (many diffs) n/a
Download CSV