Transcript: Mouse NR_003523.1

Mus musculus H2A histone family, member Y3 (H2afy3), non-coding RNA.

Source:
NCBI, updated 2013-07-16
Taxon:
Mus musculus (mouse)
Gene:
H2afy3 (67552)
Length:
1911
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003523.1
NBCI Gene record:
H2afy3 (67552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_003523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093013 CGTTCACAGTTTCTTTGTCTT pLKO.1 1622 3UTR 100% 4.950 3.465 N H2afy3 n/a
2 TRCN0000093016 CGTCGAAGAAGTCTAAAGCAA pLKO.1 583 3UTR 100% 3.000 1.800 N H2afy3 n/a
3 TRCN0000371036 AGAGTGACATCAGCCATATTG pLKO_005 718 3UTR 100% 13.200 6.600 Y MACROH2A2 n/a
4 TRCN0000096926 CCAGAGTGACATCAGCCATAT pLKO.1 716 3UTR 100% 10.800 5.400 Y Macroh2a2 n/a
5 TRCN0000096928 GCTACTGAAAGGAGTGACTAT pLKO.1 398 3UTR 100% 4.950 2.475 Y Macroh2a2 n/a
6 TRCN0000093014 GCCCTTTAGAAATCGCTGAAA pLKO.1 874 3UTR 100% 4.950 3.465 N H2afy3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1597 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03596 pDONR223 100% 51.1% None (many diffs) n/a
2 ccsbBroad304_03596 pLX_304 0% 51.1% V5 (many diffs) n/a
3 TRCN0000478248 CGCGAGTATGCAGGAATCCATCCC pLX_317 24.7% 51.1% V5 (many diffs) n/a
Download CSV