Transcript: Human NR_003680.1

Homo sapiens ribosomal protein L13a pseudogene 17 (RPL13AP17), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
RPL13AP17 (399670)
Length:
1848
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003680.1
NBCI Gene record:
RPL13AP17 (399670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129709 CATCACTAAGCCATTACTCTT pLKO.1 501 3UTR 100% 4.950 6.930 N RPL13AP17 n/a
2 TRCN0000149312 GTGCACCATCAATCATGTCAT pLKO.1 571 3UTR 100% 4.950 3.960 N RPL13AP17 n/a
3 TRCN0000146366 CCTTAGTCACTGCCTTTCTAT pLKO.1 1391 3UTR 100% 5.625 3.938 N RPL13AP17 n/a
4 TRCN0000149852 CGTGGAGAAGACAAATGACAA pLKO.1 1153 3UTR 100% 4.950 3.465 N RPL13AP17 n/a
5 TRCN0000146629 CTAAGCCATTACTCTTCACTA pLKO.1 506 3UTR 100% 4.950 3.465 N RPL13AP17 n/a
6 TRCN0000129296 CGAACTAACTCCTAGCAGACA pLKO.1 543 3UTR 100% 2.640 1.848 N RPL13AP17 n/a
7 TRCN0000128254 GAAGATTCATCACTAAGCCAT pLKO.1 494 3UTR 100% 2.640 1.848 N RPL13AP17 n/a
8 TRCN0000117721 CATCAACATTTCTGGCAATTT pLKO.1 745 3UTR 100% 13.200 6.600 Y RPL13A n/a
9 TRCN0000117718 GCATCAACATTTCTGGCAATT pLKO.1 744 3UTR 100% 10.800 5.400 Y RPL13A n/a
10 TRCN0000147525 GCATCAACATTTCTGGCAATT pLKO.1 744 3UTR 100% 10.800 5.400 Y RPL13AP17 n/a
11 TRCN0000117719 CCTACAAGAAAGTTTGCCTAT pLKO.1 992 3UTR 100% 4.050 2.025 Y RPL13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10626 pDONR223 100% 27.3% None (many diffs) n/a
2 ccsbBroad304_10626 pLX_304 0% 27.3% V5 (many diffs) n/a
3 TRCN0000478711 ACGTATTAACAGTGGTTGGTCGAA pLX_317 58.3% 27.3% V5 (many diffs) n/a
Download CSV