Transcript: Human NR_015341.2

Homo sapiens SMURF2P1-LRRC37BP1 readthrough transcribed pseudogene (SMURF2P1-LRRC37BP1), non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
SMURF2P1-LRRC37BP1 (107133515)
Length:
4607
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_015341.2
NBCI Gene record:
SMURF2P1-LRRC37BP1 (107133515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_015341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135236 CGCAATATCTGTGACTGTCAT pLKO.1 1172 3UTR 100% 4.950 2.970 N LRRC37BP1 n/a
2 TRCN0000133719 GCAATATCTGTGACTGTCATA pLKO.1 1173 3UTR 100% 4.950 2.970 N LRRC37BP1 n/a
3 TRCN0000136505 CGAGGATGTGAGAAAGTTCAT pLKO.1 884 3UTR 100% 4.950 2.475 Y LRRC37BP1 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2341 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000161279 GAATGAACAGAAAGAGCAGAA pLKO.1 1094 3UTR 100% 4.050 2.025 Y LRRC37B n/a
6 TRCN0000134526 GCATTGAATGTAGAATGGGAT pLKO.1 1029 3UTR 100% 2.640 1.320 Y LRRC37BP1 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2342 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_015341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13237 pDONR223 100% 15% None 1_696del;831_832ins52;1398_4607del n/a
2 ccsbBroad304_13237 pLX_304 0% 15% V5 1_696del;831_832ins52;1398_4607del n/a
3 TRCN0000467884 ACCCGCGACTCCAGGATTGTGATT pLX_317 53.8% 15% V5 1_696del;831_832ins52;1398_4607del n/a
Download CSV