Transcript: Mouse NR_015577.1

Mus musculus ubiquitin-conjugating enzyme E2D, pseudogene (Ube2d-ps), long non-coding RNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Ube2d-ps (76508)
Length:
1840
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_015577.1
NBCI Gene record:
Ube2d-ps (76508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_015577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040651 GCTTTCACTACCAGAATCTAT pLKO.1 422 3UTR 100% 5.625 7.875 N LOC383042 n/a
2 TRCN0000040650 CCAGCACTGACTGTGTCTAAA pLKO.1 503 3UTR 100% 13.200 9.240 N LOC383042 n/a
3 TRCN0000040649 GCATCAACTTTACTTGCATTT pLKO.1 770 3UTR 100% 10.800 7.560 N LOC383042 n/a
4 TRCN0000040648 CCCTACAGATTATCCTTTCAA pLKO.1 388 3UTR 100% 5.625 3.938 N LOC383042 n/a
5 TRCN0000004124 CACCCTAATATCAACAGCAAT pLKO.1 443 3UTR 100% 4.950 3.465 N UBE2D4 n/a
6 TRCN0000004123 ATCACCCTAATATCAACAGCA pLKO.1 441 3UTR 100% 2.640 1.848 N UBE2D4 n/a
7 TRCN0000272499 CTAGCAAGAGAGTGGACACAA pLKO_005 1032 3UTR 100% 4.950 3.960 N UBE2D4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_015577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03347 pDONR223 100% 21.5% None (many diffs) n/a
2 ccsbBroad304_03347 pLX_304 0% 21.5% V5 (many diffs) n/a
3 TRCN0000474875 GGAGATCAGCCTGCAATCCTGTTA pLX_317 72.2% 21.5% V5 (many diffs) n/a
Download CSV