Transcript: Human NR_023351.3

Homo sapiens SPRY domain containing 7 (SPRYD7), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SPRYD7 (57213)
Length:
2773
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_023351.3
NBCI Gene record:
SPRYD7 (57213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_023351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072717 CTTATGACCATGTCGAATTAA pLKO.1 219 3UTR 100% 15.000 12.000 N SPRYD7 n/a
2 TRCN0000300086 CTTATGACCATGTCGAATTAA pLKO_005 219 3UTR 100% 15.000 12.000 N SPRYD7 n/a
3 TRCN0000303806 CACCCTGAAGTTGTGATTTAA pLKO_005 557 3UTR 100% 15.000 10.500 N SPRYD7 n/a
4 TRCN0000303808 GACAGTGTATCCAGTTGTTTA pLKO_005 292 3UTR 100% 13.200 9.240 N SPRYD7 n/a
5 TRCN0000072713 CCCTCCTTTATCAACTAGAAA pLKO.1 1438 3UTR 100% 5.625 3.938 N SPRYD7 n/a
6 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 2290 3UTR 100% 13.200 6.600 Y LRRC74B n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1669 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1669 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1667 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1667 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1667 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_023351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08717 pDONR223 100% 10.3% None (many diffs) n/a
2 TRCN0000470473 TTCATAAACATATGGGTGTCTATC pLX_317 85.5% 10.3% V5 (many diffs) n/a
Download CSV