Transcript: Human NR_023353.1

Homo sapiens exosome component 7 (EXOSC7), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
EXOSC7 (23016)
Length:
1246
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_023353.1
NBCI Gene record:
EXOSC7 (23016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_023353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051071 GAGATCGCTAACACCCTCTAT pLKO.1 142 3UTR 100% 4.950 6.930 N EXOSC7 n/a
2 TRCN0000051070 CATACGACTAAGTGTGGAGAA pLKO.1 399 3UTR 100% 4.050 5.670 N EXOSC7 n/a
3 TRCN0000438484 AGCACTGCTGGGTTCTCTATG pLKO_005 221 3UTR 100% 10.800 7.560 N EXOSC7 n/a
4 TRCN0000434452 CTTAAAGACCCTCTGCATTAG pLKO_005 192 3UTR 100% 10.800 7.560 N EXOSC7 n/a
5 TRCN0000433811 CAGAGAGCATCTTCGAGATGA pLKO_005 578 3UTR 100% 4.950 3.465 N EXOSC7 n/a
6 TRCN0000428275 CATGTGGTGGATGCTACTCTT pLKO_005 460 3UTR 100% 4.950 3.465 N EXOSC7 n/a
7 TRCN0000051069 GCTTCTGGAATGTGGTGGAAA pLKO.1 252 3UTR 100% 4.950 3.465 N EXOSC7 n/a
8 TRCN0000429986 AGAAGGTGTACATCGTGCATG pLKO_005 58 3UTR 100% 4.050 2.835 N EXOSC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_023353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07829 pDONR223 100% 46.7% None (many diffs) n/a
2 ccsbBroad304_07829 pLX_304 0% 46.7% V5 (many diffs) n/a
3 TRCN0000471315 CCGAACCAGGACAAAGAAAGTCTG pLX_317 36.6% 46.7% V5 (many diffs) n/a
Download CSV