Transcript: Human NR_023384.1

Homo sapiens ring finger protein 216 pseudogene 1 (RNF216P1), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
RNF216P1 (441191)
Length:
2443
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_023384.1
NBCI Gene record:
RNF216P1 (441191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_023384.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010789 ACACTATGCAATCACCCGAAA pLKO.1 561 3UTR 100% 4.050 2.025 Y RNF216 n/a
2 TRCN0000272691 ACACTATGCAATCACCCGAAA pLKO_005 561 3UTR 100% 4.050 2.025 Y RNF216 n/a
3 TRCN0000141645 CTATTTCTCCTGGTTCAACGT pLKO.1 1160 3UTR 100% 2.640 1.320 Y XKR8 n/a
4 TRCN0000003466 GACACTATGCAATCACCCGAA pLKO.1 560 3UTR 100% 2.160 1.080 Y RNF216 n/a
5 TRCN0000144061 CCACACCATTCATTCAATTCA pLKO.1 1975 3UTR 100% 5.625 2.813 Y XKR8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_023384.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10647 pDONR223 100% 9.2% None 1_498del;724_2443del n/a
2 ccsbBroad304_10647 pLX_304 0% 9.2% V5 1_498del;724_2443del n/a
3 TRCN0000475787 AGGGTTGCTCTCTGCCTCCACAGC pLX_317 100% 9.2% V5 1_498del;724_2443del n/a
Download CSV