Transcript: Human NR_023392.1

Homo sapiens zinc finger protein 252, pseudogene (ZNF252P), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZNF252P (286101)
Length:
5454
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_023392.1
NBCI Gene record:
ZNF252P (286101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_023392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239829 AGGAGAGAAACCCTATGAATG pLKO_005 1889 3UTR 100% 10.800 5.400 Y Gm14393 n/a
2 TRCN0000152004 CTGGTGAGAAACCTTATGAAT pLKO.1 2392 3UTR 100% 5.625 2.813 Y ZNF829 n/a
3 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3925 3UTR 100% 4.950 2.475 Y CFLAR n/a
4 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3925 3UTR 100% 4.950 2.475 Y C19orf31 n/a
5 TRCN0000164124 CTGGAGAGAAACCCTACATAT pLKO.1 2476 3UTR 100% 13.200 6.600 Y ZNF718 n/a
6 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4087 3UTR 100% 10.800 5.400 Y SMIM11A n/a
7 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1468 3UTR 100% 5.625 2.813 Y ZNF345 n/a
8 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3923 3UTR 100% 4.950 2.475 Y ERN2 n/a
9 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3923 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3923 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 2474 3UTR 100% 4.950 2.475 Y ZNF254 n/a
12 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 1635 3UTR 100% 15.000 7.500 Y Gm10771 n/a
13 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 1635 3UTR 100% 15.000 7.500 Y ZNF286B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_023392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.