Transcript: Human NR_024024.1

Homo sapiens acetyl-CoA acyltransferase 1 (ACAA1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
ACAA1 (30)
Length:
1965
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024024.1
NBCI Gene record:
ACAA1 (30)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036071 CGTCTTTGAATACCCTGGGAA pLKO.1 1583 3UTR 100% 2.640 3.696 N ACAA1 n/a
2 TRCN0000036070 GTGGACATCTTCGAGATCAAT pLKO.1 1347 3UTR 100% 5.625 4.500 N ACAA1 n/a
3 TRCN0000036073 GCCTTCAAGAAAGATGGTTCT pLKO.1 951 3UTR 100% 4.050 2.835 N ACAA1 n/a
4 TRCN0000036072 GTTTGGCATTTCACGGGAGAA pLKO.1 737 3UTR 100% 4.050 2.835 N ACAA1 n/a
5 TRCN0000036069 CCACTGTCAATAGACAGTGTT pLKO.1 557 3UTR 100% 0.495 0.347 N ACAA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00004 pDONR223 100% 61.2% None (many diffs) n/a
2 TRCN0000479705 CATTGCATGACGAAACGACATTCC pLX_317 24.5% 61.2% V5 (many diffs) n/a
3 ccsbBroadEn_05756 pDONR223 100% 49.9% None (many diffs) n/a
4 ccsbBroad304_05756 pLX_304 0% 49.9% V5 (many diffs) n/a
5 TRCN0000474186 TGTATAACCACATTTATCGGGCTC pLX_317 51.8% 49.9% V5 (many diffs) n/a
Download CSV