Transcript: Human NR_024047.2

Homo sapiens Wnt family member 2 (WNT2), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
WNT2 (7472)
Length:
3792
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024047.2
NBCI Gene record:
WNT2 (7472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373977 CCACAAATGGTCCCAATTAAG pLKO_005 1476 3UTR 100% 13.200 18.480 N WNT2 n/a
2 TRCN0000033373 CCTGTAGCCAAGGAGAAGTAA pLKO.1 382 3UTR 100% 5.625 3.938 N WNT2 n/a
3 TRCN0000033372 CCGCGCATTTGTGGATGCAAA pLKO.1 509 3UTR 100% 4.950 3.465 N WNT2 n/a
4 TRCN0000033371 CCAGATGTGATGCGTGCCATT pLKO.1 244 3UTR 100% 4.050 2.835 N WNT2 n/a
5 TRCN0000033369 GCTCATGTACTCTCAGGACAT pLKO.1 643 3UTR 100% 4.050 2.835 N WNT2 n/a
6 TRCN0000033370 CACAGGTTTCACTGTGGCTAA pLKO.1 755 3UTR 100% 0.405 0.284 N WNT2 n/a
7 TRCN0000373978 TTGACTATGGGATCAAATTTG pLKO_005 487 3UTR 100% 13.200 7.920 N WNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01778 pDONR223 100% 26.3% None 1_69del;379_380ins64;1086_3792del n/a
2 ccsbBroad304_01778 pLX_304 0% 26.3% V5 1_69del;379_380ins64;1086_3792del n/a
3 TRCN0000468916 GATTATTAGTCAGGACCTGATCGC pLX_317 33.2% 26.3% V5 1_69del;379_380ins64;1086_3792del n/a
Download CSV