Transcript: Human NR_024058.1

Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon (YWHAE), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
YWHAE (7531)
Length:
1860
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024058.1
NBCI Gene record:
YWHAE (7531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062236 GCTGACAGTTGAAGAAAGAAA pLKO.1 293 3UTR 100% 5.625 3.938 N YWHAE n/a
2 TRCN0000012387 GCTGAGTGAAGAAAGCTATAA pLKO.1 809 3UTR 100% 13.200 6.600 Y Ywhae n/a
3 TRCN0000062234 GCTTAGGTCTTGCTCTCAATT pLKO.1 694 3UTR 100% 13.200 6.600 Y YWHAE n/a
4 TRCN0000290215 GCTTAGGTCTTGCTCTCAATT pLKO_005 694 3UTR 100% 13.200 6.600 Y YWHAE n/a
5 TRCN0000062233 CGCTGAGTGAAGAAAGCTATA pLKO.1 808 3UTR 100% 10.800 5.400 Y YWHAE n/a
6 TRCN0000290141 CGCTGAGTGAAGAAAGCTATA pLKO_005 808 3UTR 100% 10.800 5.400 Y YWHAE n/a
7 TRCN0000062235 CCACAGGTATCTGGCAGAATT pLKO.1 569 3UTR 100% 0.000 0.000 Y YWHAE n/a
8 TRCN0000290216 CCACAGGTATCTGGCAGAATT pLKO_005 569 3UTR 100% 0.000 0.000 Y YWHAE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13983 pDONR223 100% 41% None (many diffs) n/a
2 ccsbBroad304_13983 pLX_304 0% 41% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000472772 CCTCGGTCAGCGATTTATAACCTT pLX_317 73.7% 41% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV