Transcript: Human NR_024203.1

Homo sapiens ecdysoneless cell cycle regulator (ECD), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
ECD (11319)
Length:
1869
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024203.1
NBCI Gene record:
ECD (11319)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016031 CCCAGACTACCGATAACAATT pLKO.1 1547 3UTR 100% 13.200 18.480 N ECD n/a
2 TRCN0000318856 CCCAGACTACCGATAACAATT pLKO_005 1547 3UTR 100% 13.200 18.480 N ECD n/a
3 TRCN0000086602 CTCCAAATGTAGCCCACATTT pLKO.1 768 3UTR 100% 1.320 1.056 N Ecd n/a
4 TRCN0000086600 GCTCCAAATGTAGCCCACATT pLKO.1 767 3UTR 100% 0.495 0.396 N Ecd n/a
5 TRCN0000416609 ATTGAGGATGAATGGTTTATT pLKO_005 278 3UTR 100% 15.000 10.500 N Ecd n/a
6 TRCN0000274356 CTCATGGATTTGAGATCTTAT pLKO_005 746 3UTR 100% 13.200 9.240 N ECD n/a
7 TRCN0000016029 CCAGAGTTAGTAGCAAGGATT pLKO.1 332 3UTR 100% 4.950 3.465 N ECD n/a
8 TRCN0000274358 CCAGAGTTAGTAGCAAGGATT pLKO_005 332 3UTR 100% 4.950 3.465 N ECD n/a
9 TRCN0000016030 CCCAACAATTCCACAAGCATT pLKO.1 517 3UTR 100% 4.950 3.465 N ECD n/a
10 TRCN0000016032 CCATTTGATATAGAAGACCTT pLKO.1 1012 3UTR 100% 2.640 1.848 N ECD n/a
11 TRCN0000016028 GCCCATGAATTGGGCATGAAA pLKO.1 721 3UTR 100% 0.563 0.394 N ECD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02671 pDONR223 100% 77.3% None (many diffs) n/a
2 ccsbBroad304_02671 pLX_304 0% 77.3% V5 (many diffs) n/a
3 TRCN0000470911 ATCCGACAGTATGCGCCCTAGTGA pLX_317 17.4% 77.3% V5 (many diffs) n/a
Download CSV