Transcript: Human NR_024210.2

Homo sapiens ring finger protein 185 (RNF185), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RNF185 (91445)
Length:
3349
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024210.2
NBCI Gene record:
RNF185 (91445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040758 GCCGTGTTTACATCAGTGGTT pLKO.1 350 3UTR 100% 2.640 3.696 N Rnf185 n/a
2 TRCN0000034056 GTTTACATCAGTGGTTGGAGA pLKO.1 355 3UTR 100% 2.640 3.696 N RNF185 n/a
3 TRCN0000034054 GCTTGATAGAGTTCCCTGAAA pLKO.1 2007 3UTR 100% 4.950 3.960 N RNF185 n/a
4 TRCN0000434510 ACCGCTGTAAACACTCTATAA pLKO_005 1107 3UTR 100% 13.200 9.240 N RNF185 n/a
5 TRCN0000350041 CTCTTCTGTTGGCCGTGTTTA pLKO_005 339 3UTR 100% 13.200 9.240 N Rnf185 n/a
6 TRCN0000422049 AGGTGTGTCCTGTTTGCAAAG pLKO_005 391 3UTR 100% 6.000 4.200 N RNF185 n/a
7 TRCN0000034055 CCTCTTCTGTTGGCCGTGTTT pLKO.1 338 3UTR 100% 4.950 3.465 N RNF185 n/a
8 TRCN0000034057 AGGGCAGGACAGCACTTTCGA pLKO.1 263 3UTR 100% 1.000 0.700 N RNF185 n/a
9 TRCN0000420466 GCATTTCCCTTTGGGATATTT pLKO_005 758 3UTR 100% 15.000 7.500 Y RNF185 n/a
10 TRCN0000420873 TCTGGCTCCTGATTGCCTAAT pLKO_005 897 3UTR 100% 10.800 5.400 Y RNF185 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04546 pDONR223 100% 17.1% None 1_170del;533_699del;914_3349del n/a
2 ccsbBroad304_04546 pLX_304 0% 17.1% V5 1_170del;533_699del;914_3349del n/a
3 TRCN0000471609 CCAATCCGCCACAACTATGGTCAA pLX_317 62.9% 17.1% V5 1_170del;533_699del;914_3349del n/a
Download CSV