Transcript: Human NR_024212.2

Homo sapiens ring finger protein 185 (RNF185), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RNF185 (91445)
Length:
2958
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024212.2
NBCI Gene record:
RNF185 (91445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040758 GCCGTGTTTACATCAGTGGTT pLKO.1 126 3UTR 100% 2.640 3.696 N Rnf185 n/a
2 TRCN0000034056 GTTTACATCAGTGGTTGGAGA pLKO.1 131 3UTR 100% 2.640 3.696 N RNF185 n/a
3 TRCN0000034054 GCTTGATAGAGTTCCCTGAAA pLKO.1 1616 3UTR 100% 4.950 3.960 N RNF185 n/a
4 TRCN0000434510 ACCGCTGTAAACACTCTATAA pLKO_005 716 3UTR 100% 13.200 9.240 N RNF185 n/a
5 TRCN0000422049 AGGTGTGTCCTGTTTGCAAAG pLKO_005 167 3UTR 100% 6.000 4.200 N RNF185 n/a
6 TRCN0000420466 GCATTTCCCTTTGGGATATTT pLKO_005 367 3UTR 100% 15.000 7.500 Y RNF185 n/a
7 TRCN0000420873 TCTGGCTCCTGATTGCCTAAT pLKO_005 506 3UTR 100% 10.800 5.400 Y RNF185 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04546 pDONR223 100% 15.6% None (many diffs) n/a
2 ccsbBroad304_04546 pLX_304 0% 15.6% V5 (many diffs) n/a
3 TRCN0000471609 CCAATCCGCCACAACTATGGTCAA pLX_317 62.9% 15.6% V5 (many diffs) n/a
Download CSV