Transcript: Human NR_024438.2

Homo sapiens actin gamma 1 pseudogene 4 (ACTG1P4), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
ACTG1P4 (648740)
Length:
1988
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024438.2
NBCI Gene record:
ACTG1P4 (648740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029476 CCAGCAGATGTGGATTAGCAA pLKO.1 1199 3UTR 100% 3.000 1.500 Y ACTG1 n/a
2 TRCN0000089842 TGTGCTATGTTGCCCTGGATT pLKO.1 794 3UTR 100% 4.950 2.475 Y Actg-ps1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15351 pDONR223 0% 49.1% None (many diffs) n/a
2 ccsbBroad304_15351 pLX_304 0% 49.1% V5 (many diffs) n/a
3 ccsbBroadEn_13808 pDONR223 100% 49.1% None (many diffs) n/a
4 ccsbBroad304_13808 pLX_304 0% 49.1% V5 (not translated due to frame shift) (many diffs) n/a
5 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 49.1% V5 (not translated due to frame shift) (many diffs) n/a
6 ccsbBroadEn_05764 pDONR223 100% 49.1% None (many diffs) n/a
7 ccsbBroad304_05764 pLX_304 0% 49.1% V5 (many diffs) n/a
8 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 49.1% V5 (many diffs) n/a
Download CSV