Transcript: Human NR_024592.1

Homo sapiens POM121 transmembrane nucleoporin like 4, pseudogene (POM121L4P), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
POM121L4P (266697)
Length:
2167
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024592.1
NBCI Gene record:
POM121L4P (266697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162242 CAGAGGTCAGAAATCAGATAT pLKO.1 768 3UTR 100% 13.200 6.600 Y POM121L9P n/a
2 TRCN0000163328 CCAGAGGTCAGAAATCAGATA pLKO.1 767 3UTR 100% 4.950 2.475 Y POM121L9P n/a
3 TRCN0000166031 CCCAGAGGTCAGAAATCAGAT pLKO.1 766 3UTR 100% 4.950 2.475 Y POM121L9P n/a
4 TRCN0000165033 GTCCAAGAGAATCCTGGTGAT pLKO.1 627 3UTR 100% 4.050 2.025 Y POM121L9P n/a
5 TRCN0000165098 CCTCAGTTCCTCAAACACAGT pLKO.1 1852 3UTR 100% 2.640 1.320 Y LOC729915 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10587 pDONR223 100% 59% None (many diffs) n/a
2 ccsbBroad304_10587 pLX_304 0% 59% V5 (many diffs) n/a
3 TRCN0000472538 GCTGGAAACCAGACTTGAAGCAAA pLX_317 39.6% 59% V5 (many diffs) n/a
Download CSV