Transcript: Human NR_026785.1

Homo sapiens RHPN1 antisense RNA 1 (head to head) (RHPN1-AS1), long non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
RHPN1-AS1 (78998)
Length:
2030
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026785.1
NBCI Gene record:
RHPN1-AS1 (78998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172885 GCTCAGAACACACCCTTTGAA pLKO.1 792 3UTR 100% 5.625 3.938 N RHPN1-AS1 n/a
2 TRCN0000167209 CATGTGTGACTGAAATGGTAT pLKO.1 1825 3UTR 100% 4.950 3.465 N RHPN1-AS1 n/a
3 TRCN0000172806 GTACAGAACCCACATCCTTCT pLKO.1 448 3UTR 100% 4.050 2.835 N RHPN1-AS1 n/a
4 TRCN0000168659 GCAAGCATGTGTGACTGAAAT pLKO.1 1820 3UTR 100% 13.200 7.920 N RHPN1-AS1 n/a
5 TRCN0000172511 CCAAACCCTCTTAGCAGTCTT pLKO.1 1751 3UTR 100% 4.950 2.970 N RHPN1-AS1 n/a
6 TRCN0000172660 GTCTCAAACTTCTGGGCTCAA pLKO.1 1344 3UTR 100% 4.050 2.025 Y RHPN1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10247 pDONR223 100% 8.7% None 1_290del;468_2030del n/a
2 ccsbBroad304_10247 pLX_304 0% 8.7% V5 1_290del;468_2030del n/a
3 TRCN0000473934 GTCTATCCATAATGCTTTAATTAC pLX_317 100% 8.7% V5 1_290del;468_2030del n/a
Download CSV