Transcript: Human NR_027064.3

Homo sapiens TINCR ubiquitin domain containing (TINCR), long non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
TINCR (257000)
Length:
3733
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027064.3
NBCI Gene record:
TINCR (257000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027064.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122375 CAGCTCCAATACACCTGGGAT pLKO.1 899 3UTR 100% 2.640 3.696 N TINCR n/a
2 TRCN0000141704 CGCAAGAAGAGAAGCACAGAA pLKO.1 766 3UTR 100% 4.950 3.465 N TINCR n/a
3 TRCN0000122346 CCTGTGCATATTCAGGGACAT pLKO.1 2119 3UTR 100% 4.050 2.835 N TINCR n/a
4 TRCN0000143894 CAGTTTCATTCCTTGGTCCTT pLKO.1 2186 3UTR 100% 2.640 1.848 N TINCR n/a
5 TRCN0000141606 CTGCTGTGTGACTTTGAGGTT pLKO.1 655 3UTR 100% 2.640 1.848 N TINCR n/a
6 TRCN0000142299 GTCTTCTCAGATTCCCTCCTT pLKO.1 938 3UTR 100% 2.640 1.848 N TINCR n/a
7 TRCN0000142526 GTTCTGAAGAACTCTGGCCAA pLKO.1 1238 3UTR 100% 2.160 1.512 N TINCR n/a
8 TRCN0000122788 GCCACCTTGGAAAGCTCCCAT pLKO.1 728 3UTR 100% 0.880 0.616 N TINCR n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2285 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2286 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027064.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10584 pDONR223 100% 12.1% None 1_522del;835T>C;976_3733del n/a
2 ccsbBroad304_10584 pLX_304 0% 12.1% V5 1_522del;835T>C;976_3733del n/a
3 TRCN0000491980 GGTTACCCCCCCCTCGCAATCAAA pLX_317 69.5% 12.1% V5 1_522del;835T>C;976_3733del n/a
Download CSV